dual index adapters Search Results


91
roche kk8727

Kk8727, supplied by roche, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kk8727/product/roche
Average 91 stars, based on 1 article reviews
kk8727 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

93
Vazyme Biotech Co vahts tm dna adapters set1 for illumina

Vahts Tm Dna Adapters Set1 For Illumina, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vahts tm dna adapters set1 for illumina/product/Vazyme Biotech Co
Average 93 stars, based on 1 article reviews
vahts tm dna adapters set1 for illumina - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Illumina Inc sequencing adapter for illumina nextera dna unique dual index

Sequencing Adapter For Illumina Nextera Dna Unique Dual Index, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequencing adapter for illumina nextera dna unique dual index/product/Illumina Inc
Average 95 stars, based on 1 article reviews
sequencing adapter for illumina nextera dna unique dual index - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

96
Illumina Inc dna flex dual index adapters

Dna Flex Dual Index Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna flex dual index adapters/product/Illumina Inc
Average 96 stars, based on 1 article reviews
dna flex dual index adapters - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

95
Illumina Inc dna unique dual indexes

Dna Unique Dual Indexes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna unique dual indexes/product/Illumina Inc
Average 95 stars, based on 1 article reviews
dna unique dual indexes - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Illumina Inc sequencing adapters and dual-index barcodes (index 1(i7) and index 2(i5)

Sequencing Adapters And Dual Index Barcodes (Index 1(I7) And Index 2(I5), supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequencing adapters and dual-index barcodes (index 1(i7) and index 2(i5)/product/Illumina Inc
Average 90 stars, based on 1 article reviews
sequencing adapters and dual-index barcodes (index 1(i7) and index 2(i5) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc dual index adapters

Dual Index Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dual index adapters/product/Illumina Inc
Average 90 stars, based on 1 article reviews
dual index adapters - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen qiaseq fx 24-plex dual-indexed adapters

Qiaseq Fx 24 Plex Dual Indexed Adapters, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qiaseq fx 24-plex dual-indexed adapters/product/Qiagen
Average 90 stars, based on 1 article reviews
qiaseq fx 24-plex dual-indexed adapters - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc multiple index adapters truseq rna combinatorial dual indexes

Multiple Index Adapters Truseq Rna Combinatorial Dual Indexes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple index adapters truseq rna combinatorial dual indexes/product/Illumina Inc
Average 90 stars, based on 1 article reviews
multiple index adapters truseq rna combinatorial dual indexes - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc adapters and dual multiplexing indexes reverse primer

Adapters And Dual Multiplexing Indexes Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/adapters and dual multiplexing indexes reverse primer/product/Illumina Inc
Average 90 stars, based on 1 article reviews
adapters and dual multiplexing indexes reverse primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc unique dual index adapters

Unique Dual Index Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/unique dual index adapters/product/Illumina Inc
Average 90 stars, based on 1 article reviews
unique dual index adapters - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc fusion primers for dual indexing and incorporation of adapters

Fusion Primers For Dual Indexing And Incorporation Of Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fusion primers for dual indexing and incorporation of adapters/product/Illumina Inc
Average 90 stars, based on 1 article reviews
fusion primers for dual indexing and incorporation of adapters - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Journal: Cell Reports

Article Title: B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

doi: 10.1016/j.celrep.2022.110393

Figure Lengend Snippet:

Article Snippet: KAPA Dual-Indexed Adapter Kit , KAPA Biosystems , Cat# KK8727, Cat# KK8721.

Techniques: Recombinant, Library Amplification, Flow Cytometry, Cell Counting, Software

Journal: iScience

Article Title: Characterizing adjuvants’ effects at murine immunoglobulin repertoire level

doi: 10.1016/j.isci.2023.108749

Figure Lengend Snippet:

Article Snippet: Illumina adapters and dual multiplexing indexes reverse primer , Illumina , CAAGCAGAAGACGGCATACGAG AT-[i7 index]-GTCTCGTGGGCTCG∗G.

Techniques: Cell Isolation, Reverse Transcription, Multiplexing, Software, Gene Expression